ID: 903848656_903848662

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 903848656 903848662
Species Human (GRCh38) Human (GRCh38)
Location 1:26293316-26293338 1:26293358-26293380
Sequence CCATTCTTTGAAGAGAATGGGCC GTTTTATGGACCCAAATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 136} {0: 1, 1: 0, 2: 2, 3: 12, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!