ID: 903876247_903876254

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 903876247 903876254
Species Human (GRCh38) Human (GRCh38)
Location 1:26475395-26475417 1:26475428-26475450
Sequence CCTCTTGGCTCCCAGGAGGAGGG TTTGACACACATGGCCACCTTGG
Strand - +
Off-target summary {0: 25, 1: 11, 2: 9, 3: 38, 4: 321} {0: 20, 1: 14, 2: 7, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!