ID: 903888861_903888876

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 903888861 903888876
Species Human (GRCh38) Human (GRCh38)
Location 1:26556729-26556751 1:26556769-26556791
Sequence CCACCCACACCAGGGCTCTGGCC GCCACAGGAAGGGTGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 515} {0: 1, 1: 0, 2: 9, 3: 60, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!