ID: 903928441_903928457

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903928441 903928457
Species Human (GRCh38) Human (GRCh38)
Location 1:26848594-26848616 1:26848646-26848668
Sequence CCTCCTTCCCTCAGACAACACAG ACCCGGGAGGTGCTGATCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 326} {0: 1, 1: 0, 2: 1, 3: 7, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!