ID: 903941177_903941183

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 903941177 903941183
Species Human (GRCh38) Human (GRCh38)
Location 1:26932473-26932495 1:26932512-26932534
Sequence CCGGCCCCCAGCTAATTTTTCTG GAGGTTTTACCATGTTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 20, 3: 255, 4: 1524} {0: 5, 1: 169, 2: 3024, 3: 29555, 4: 155490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!