ID: 903943115_903943123

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 903943115 903943123
Species Human (GRCh38) Human (GRCh38)
Location 1:26945251-26945273 1:26945280-26945302
Sequence CCTCTGGATCCAGTGTAGGCCTG TCTCAGGTGCAGGATGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142} {0: 1, 1: 1, 2: 2, 3: 28, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!