ID: 903970383_903970393

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903970383 903970393
Species Human (GRCh38) Human (GRCh38)
Location 1:27115028-27115050 1:27115080-27115102
Sequence CCACCCACTTTAAAGATGGGGCA CCCAAAGTCACACAGCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 343} {0: 2, 1: 25, 2: 147, 3: 479, 4: 1295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!