ID: 903970626_903970633

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 903970626 903970633
Species Human (GRCh38) Human (GRCh38)
Location 1:27116636-27116658 1:27116665-27116687
Sequence CCCCCAGTCTTTGTACTGTCCAC ACATCCAGTGTGTAGCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161} {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!