ID: 903982706_903982716

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903982706 903982716
Species Human (GRCh38) Human (GRCh38)
Location 1:27201400-27201422 1:27201441-27201463
Sequence CCCTTCACCACGGTAATGTTCTC GGTGACCCGGCGGGTGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!