ID: 903982707_903982719

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903982707 903982719
Species Human (GRCh38) Human (GRCh38)
Location 1:27201401-27201423 1:27201453-27201475
Sequence CCTTCACCACGGTAATGTTCTCA GGTGCTGGTGGTCCCACCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 121} {0: 1, 1: 0, 2: 0, 3: 20, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!