ID: 904042650_904042670

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 904042650 904042670
Species Human (GRCh38) Human (GRCh38)
Location 1:27593393-27593415 1:27593441-27593463
Sequence CCACTGCTGCCGCCACCACTACC CTGGTGTCCATGGGCAAAGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 198, 4: 1032} {0: 1, 1: 0, 2: 1, 3: 23, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!