ID: 904051694_904051697

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904051694 904051697
Species Human (GRCh38) Human (GRCh38)
Location 1:27643675-27643697 1:27643695-27643717
Sequence CCCACTCAGTGGCTCTAGTGCCA CCAGACATGACACTCATTTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!