ID: 904117863_904117873

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 904117863 904117873
Species Human (GRCh38) Human (GRCh38)
Location 1:28175642-28175664 1:28175683-28175705
Sequence CCCAGCACCTGGGACCTGATAGG TGGCCCTGTGTATAAGAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 231} {0: 1, 1: 0, 2: 1, 3: 11, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!