ID: 904181297_904181303

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 904181297 904181303
Species Human (GRCh38) Human (GRCh38)
Location 1:28668699-28668721 1:28668725-28668747
Sequence CCAGCTCTCCGGCGGCGGCGGCC AGTGTTGAAGCCCGGCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 342} {0: 1, 1: 0, 2: 2, 3: 39, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!