ID: 904183905_904183909

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904183905 904183909
Species Human (GRCh38) Human (GRCh38)
Location 1:28687706-28687728 1:28687724-28687746
Sequence CCTGAATTAAGGCAGTAGCAGTG CAGTGGAGATAGAGACAGGGAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 6, 3: 60, 4: 284} {0: 1, 1: 0, 2: 1, 3: 56, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!