|
Left Crispr |
Right Crispr |
Crispr ID |
904192912 |
904192921 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:28761476-28761498
|
1:28761503-28761525
|
Sequence |
CCTGTAATCCCAGCACATAACGG |
CAAGGCAGGTGGATCACCTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 33, 3: 968, 4: 21155} |
{0: 5146, 1: 20620, 2: 47912, 3: 74655, 4: 86900} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|