ID: 904192912_904192921

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 904192912 904192921
Species Human (GRCh38) Human (GRCh38)
Location 1:28761476-28761498 1:28761503-28761525
Sequence CCTGTAATCCCAGCACATAACGG CAAGGCAGGTGGATCACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 968, 4: 21155} {0: 5146, 1: 20620, 2: 47912, 3: 74655, 4: 86900}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!