ID: 904263187_904263191

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 904263187 904263191
Species Human (GRCh38) Human (GRCh38)
Location 1:29303090-29303112 1:29303128-29303150
Sequence CCTGTTGTTAAGCGATGCATAAG TGGGCGTGCGTGTCCCAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 117, 4: 334} {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!