ID: 904275288_904275293

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904275288 904275293
Species Human (GRCh38) Human (GRCh38)
Location 1:29379817-29379839 1:29379848-29379870
Sequence CCTCCTACAGCATGGTGCTGCTT CTCTGATTTGGTGTTTCCTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!