ID: 904282682_904282689

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 904282682 904282689
Species Human (GRCh38) Human (GRCh38)
Location 1:29432449-29432471 1:29432475-29432497
Sequence CCCACAGCCCTCTGTGCATATCC TCATGGCCCTTAACACTGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!