ID: 904336297_904336306

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904336297 904336306
Species Human (GRCh38) Human (GRCh38)
Location 1:29800468-29800490 1:29800503-29800525
Sequence CCGGGGCTGTGGAGGAGTTCACC CCGTTCCTCTCCTCCAGGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!