ID: 904513718_904513727

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 904513718 904513727
Species Human (GRCh38) Human (GRCh38)
Location 1:31036449-31036471 1:31036486-31036508
Sequence CCTCTACATGGCCAGTACTTTCG GGATCACTTGAGGCGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 60} {0: 1, 1: 5, 2: 18, 3: 150, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!