|
Left Crispr |
Right Crispr |
Crispr ID |
904517822 |
904517824 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:31070553-31070575
|
1:31070569-31070591
|
Sequence |
CCCAGGCTAGAGTACAGTGGCGT |
GTGGCGTGACCTCAGCCCCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 100, 1: 3234, 2: 39206, 3: 165066, 4: 260425} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|