ID: 904517822_904517824

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 904517822 904517824
Species Human (GRCh38) Human (GRCh38)
Location 1:31070553-31070575 1:31070569-31070591
Sequence CCCAGGCTAGAGTACAGTGGCGT GTGGCGTGACCTCAGCCCCCTGG
Strand - +
Off-target summary {0: 100, 1: 3234, 2: 39206, 3: 165066, 4: 260425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!