ID: 904615386_904615393

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 904615386 904615393
Species Human (GRCh38) Human (GRCh38)
Location 1:31746717-31746739 1:31746739-31746761
Sequence CCAACTTCCCTGCAGCCCTTCTC CCCCACAAAGGCCAGCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 70, 4: 610} {0: 1, 1: 0, 2: 3, 3: 22, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!