ID: 904615386_904615396

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 904615386 904615396
Species Human (GRCh38) Human (GRCh38)
Location 1:31746717-31746739 1:31746744-31746766
Sequence CCAACTTCCCTGCAGCCCTTCTC CAAAGGCCAGCCCCGTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 70, 4: 610} {0: 1, 1: 0, 2: 1, 3: 21, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!