ID: 904670493_904670500

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 904670493 904670500
Species Human (GRCh38) Human (GRCh38)
Location 1:32161261-32161283 1:32161312-32161334
Sequence CCAGGGGAGAGAGGCAGGACTAG CAAAATGCATTGATTTGTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 380} {0: 1, 1: 0, 2: 3, 3: 55, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!