ID: 904685663_904685665

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 904685663 904685665
Species Human (GRCh38) Human (GRCh38)
Location 1:32258391-32258413 1:32258425-32258447
Sequence CCAGAAGTTTCAGGTTGCAGTGA GTGCTGTACTACTCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 86, 2: 1575, 3: 13036, 4: 77695} {0: 1, 1: 0, 2: 13, 3: 351, 4: 3996}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!