ID: 904696008_904696020

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 904696008 904696020
Species Human (GRCh38) Human (GRCh38)
Location 1:32331956-32331978 1:32331992-32332014
Sequence CCCGAGTTCCTCCCTCTTCTGGT GTGTCTCTTGGAGGACACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259} {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!