ID: 904701649_904701661

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904701649 904701661
Species Human (GRCh38) Human (GRCh38)
Location 1:32361758-32361780 1:32361789-32361811
Sequence CCTCCGGGCTGTCCTGGGACTCG GGCAAGGCCACGGGAGTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 168} {0: 1, 1: 0, 2: 0, 3: 19, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!