ID: 904742425_904742426

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 904742425 904742426
Species Human (GRCh38) Human (GRCh38)
Location 1:32688674-32688696 1:32688695-32688717
Sequence CCTTGCGGGTTCAGGCAATTCTG TGCCTCAGCCCCCGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 72, 3: 2052, 4: 28562} {0: 81, 1: 1028, 2: 2582, 3: 2674, 4: 2656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!