ID: 904742425_904742434

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 904742425 904742434
Species Human (GRCh38) Human (GRCh38)
Location 1:32688674-32688696 1:32688723-32688745
Sequence CCTTGCGGGTTCAGGCAATTCTG CAGGCATGCACCACCACGCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 72, 3: 2052, 4: 28562} {0: 2909, 1: 15371, 2: 41698, 3: 105256, 4: 196462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!