ID: 904760909_904760924

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 904760909 904760924
Species Human (GRCh38) Human (GRCh38)
Location 1:32804216-32804238 1:32804267-32804289
Sequence CCATCGTCATCATGGCCCGTTCT CGGGGTGGCCGCCGGGCAGAGGG
Strand - +
Off-target summary {0: 414, 1: 1018, 2: 754, 3: 186, 4: 228} {0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!