|
Left Crispr |
Right Crispr |
Crispr ID |
904760909 |
904760924 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:32804216-32804238
|
1:32804267-32804289
|
Sequence |
CCATCGTCATCATGGCCCGTTCT |
CGGGGTGGCCGCCGGGCAGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 414, 1: 1018, 2: 754, 3: 186, 4: 228} |
{0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|