ID: 904766462_904766469

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 904766462 904766469
Species Human (GRCh38) Human (GRCh38)
Location 1:32852508-32852530 1:32852551-32852573
Sequence CCCACCTCCATCTGTTCTAAACT TTTGCTGTCTTTTGTCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223} {0: 1, 1: 0, 2: 4, 3: 110, 4: 642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!