ID: 904813788_904813804

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 904813788 904813804
Species Human (GRCh38) Human (GRCh38)
Location 1:33180985-33181007 1:33181019-33181041
Sequence CCCGGCCCCGCCCCTTCCCCAGG GCGCACCTGCAGCTCGTCGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 29, 3: 225, 4: 1713} {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!