ID: 904813790_904813804

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 904813790 904813804
Species Human (GRCh38) Human (GRCh38)
Location 1:33180986-33181008 1:33181019-33181041
Sequence CCGGCCCCGCCCCTTCCCCAGGC GCGCACCTGCAGCTCGTCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 42, 3: 262, 4: 1965} {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!