ID: 904823342_904823346

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 904823342 904823346
Species Human (GRCh38) Human (GRCh38)
Location 1:33258733-33258755 1:33258769-33258791
Sequence CCGCCATCATAATCTTTCCTGAG ACAGTTTTCACAGTATGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 251} {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!