ID: 904832081_904832084

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 904832081 904832084
Species Human (GRCh38) Human (GRCh38)
Location 1:33311834-33311856 1:33311848-33311870
Sequence CCTGTGTTGGGCGGGCTCTATGG GCTCTATGGTGTTGGTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79} {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!