ID: 904834482_904834486

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 904834482 904834486
Species Human (GRCh38) Human (GRCh38)
Location 1:33326077-33326099 1:33326107-33326129
Sequence CCTCATGAAGTGGGTGGTCTAGC ATTTTCAGGCAGAATGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 89} {0: 1, 1: 1, 2: 5, 3: 35, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!