ID: 904842205_904842212

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 904842205 904842212
Species Human (GRCh38) Human (GRCh38)
Location 1:33379659-33379681 1:33379683-33379705
Sequence CCATCCTCAGTGTGCTCACCCTC CTCACTCTGCCTTGGCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 342} {0: 1, 1: 0, 2: 3, 3: 90, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!