ID: 904868636_904868642

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 904868636 904868642
Species Human (GRCh38) Human (GRCh38)
Location 1:33602429-33602451 1:33602462-33602484
Sequence CCATGGCCAATGGGCACGGTGAT CAGTCCTGGGAGCTGGAGTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62} {0: 1, 1: 0, 2: 2, 3: 40, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!