ID: 904892225_904892234

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904892225 904892234
Species Human (GRCh38) Human (GRCh38)
Location 1:33788115-33788137 1:33788150-33788172
Sequence CCTCAAAACAACCAGAAGGCCCT GTGGCTGGGGCTCAGAGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 294} {0: 1, 1: 0, 2: 27, 3: 78, 4: 712}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!