ID: 904897912_904897914

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904897912 904897914
Species Human (GRCh38) Human (GRCh38)
Location 1:33831084-33831106 1:33831104-33831126
Sequence CCTGCAGGATACTATCCAGGAGA AGAACTTCTCCAATCTAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 38, 2: 52, 3: 34, 4: 134} {0: 43, 1: 3989, 2: 2590, 3: 1196, 4: 579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!