ID: 904912683_904912688

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 904912683 904912688
Species Human (GRCh38) Human (GRCh38)
Location 1:33947212-33947234 1:33947252-33947274
Sequence CCAGGGCTGTCCTAACAGACTGC CTCCTTAACCTCCCCCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 188} {0: 1, 1: 0, 2: 1, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!