ID: 904917240_904917244

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 904917240 904917244
Species Human (GRCh38) Human (GRCh38)
Location 1:33979066-33979088 1:33979112-33979134
Sequence CCTGGACTTGAACTCCACGTTTC CATGCTCCTGTCTCACCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 239} {0: 1, 1: 0, 2: 1, 3: 28, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!