ID: 905126146_905126154

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 905126146 905126154
Species Human (GRCh38) Human (GRCh38)
Location 1:35717531-35717553 1:35717574-35717596
Sequence CCATGTCCCCATGTCTCTGAAGC CAATATTACATAAACAAGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 263} {0: 1, 1: 0, 2: 1, 3: 19, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!