ID: 905149580_905149587

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 905149580 905149587
Species Human (GRCh38) Human (GRCh38)
Location 1:35917195-35917217 1:35917248-35917270
Sequence CCACAACCTGTCTGCTCTTGGAG TCCTGTGTGAAACTAACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180} {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!