ID: 905152697_905152699

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 905152697 905152699
Species Human (GRCh38) Human (GRCh38)
Location 1:35944272-35944294 1:35944297-35944319
Sequence CCAGGCTAGTCTCAAACTCCTAA TCCTAAGCCTCCTGAGTGTCTGG
Strand - +
Off-target summary {0: 85, 1: 4229, 2: 57661, 3: 135462, 4: 187555} {0: 1, 1: 1, 2: 149, 3: 5665, 4: 119411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!