ID: 905170974_905170982

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 905170974 905170982
Species Human (GRCh38) Human (GRCh38)
Location 1:36109327-36109349 1:36109380-36109402
Sequence CCCTCCTCCTTCTGGCTCTGTCT GGCTCAGGCCCTCCCTATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 152, 4: 1380} {0: 1, 1: 0, 2: 1, 3: 11, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!