ID: 905202135_905202144

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 905202135 905202144
Species Human (GRCh38) Human (GRCh38)
Location 1:36322552-36322574 1:36322576-36322598
Sequence CCTCGTCGTCGTCCTCGGGCTCC GGGTGCTGCTGCGGGGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 188} {0: 1, 1: 0, 2: 4, 3: 40, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!