ID: 905294670_905294675

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 905294670 905294675
Species Human (GRCh38) Human (GRCh38)
Location 1:36946693-36946715 1:36946708-36946730
Sequence CCATGCACCTTCTCATTTCACAG TTTCACAGATGAGGGATCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 281} {0: 1, 1: 0, 2: 35, 3: 456, 4: 3224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!