ID: 905308388_905308399

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 905308388 905308399
Species Human (GRCh38) Human (GRCh38)
Location 1:37034075-37034097 1:37034114-37034136
Sequence CCAGACTCCGGAGGCGCCGCCAG GGCGCCGCCGAGCGTGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92} {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!